Quick Order

Human HDAC10 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HDAC10cDNA Clone Product Information
cDNA Size:2010
cDNA Description:ORF Clone of Homo sapiens histone deacetylase 10 DNA.
Gene Synonym:MGC149722, DKFZp761B039, HDAC10
Restriction Site:KpnI + NotI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 435T/C not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human HDAC10 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human HDAC10 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11507-ACG$345
Human HDAC10 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11507-ACR$345
Human HDAC10 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11507-ANG$345
Human HDAC10 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11507-ANR$345
Human HDAC10 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11507-CF$315
Human HDAC10 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11507-CH$315
Human HDAC10 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11507-CM$315
Human HDAC10 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11507-CY$315
Human HDAC10 Gene cDNA Clone (full-length ORF Clone)HG11507-M$195
Human HDAC10 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11507-M-F$445
Human HDAC10 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11507-M-N$445
Human HDAC10 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11507-NF$315
Human HDAC10 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11507-NH$315
Human HDAC10 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11507-NM$315
Human HDAC10 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11507-NY$315
Human HDAC10 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11507-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability5 business days
  • Human HDAC10 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items