After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human F2 / FII Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
F2cDNA Clone Product Information
Gene_bank_ref_id:NM_000506.3
cDNA Size:1869
cDNA Description:ORF Clone of Homo sapiens coagulation factor II (thrombin) DNA.
Gene Synonym:PT, F2
Species:Human
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Coagulation Factor II Protein (FII, F2 Protein or Prothrombin) is proteolytically cleaved to form thrombin in the first step of the coagulation cascade which ultimately results in the stemming of blood loss. Coagulation Factor II Protein (FII, F2 Protein) also plays a role in maintaining vascular integrity during development and postnatal life. Prothrombin / Coagulation Factor II is activated on the surface of a phospholipid membrane that binds the amino end of prothrombin / Coagulation Factor II and factor Va and Xa in Ca-dependent interactions; factor Xa removes the activation peptide and cleaves the remaining part into light and heavy chains. The activation process starts slowly because factor V itself has to be activated by the initial, small amounts of thrombin. Prothrombin / Coagulation Factor II is expressed by the liver and secreted in plasma. Defects in prothrombin / Coagulation Factor II are the cause of factor II deficiency (FA2D). It is very rare blood coagulation disorder characterized by mucocutaneous bleeding symptoms. The severity of the bleeding manifestations correlates with blood factor II levels. Defects in Coagulation Factor II are also a cause of susceptibility to thrombosis. It is a multifactorial disorder of hemostasis characterized by abnormal platelet aggregation in response to various agents and recurrent thrombi formation.

References
  • Danneberg J, et al. (1998) Reliable genotyping of the G-20210-A mutation of Coagulation Factor II (prothrombin). Clin Chem. 44(2): 349-51.
  • Redondo M, et al. (1999) Coagulation Factor s II, V, VII, and X, prothrombin gene 20210GA transition, and factor V Leiden in coronary artery disease: high factor V clotting activity is an independent risk factor for myocardial infarction. Arterioscler Thromb Vasc Biol. 19(4): 1020-5.
  • Miletich JP, et al. (1980) The synthesis of sulfated dextran beads for isolation of human plasma Coagulation Factor s II, IX, and X. Anal Biochem. 105(2): 304-10.
  • Size / Price
    Catalog:HG11505-UT
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"