Quick Order

Human DNMT1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DNMT1 cDNA Clone Product Information
NCBI RefSeq:NM_001130823.1
RefSeq ORF Size:4899bp
cDNA Description:Full length Clone DNA of Homo sapiens DNA.(cytosine-5-)-methyltransferase 1.
Gene Synonym:AIM, DNMT, MCMT, CXXC9, FLJ16293, MGC104992, DNMT1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-DNMT1
Restriction Site:KpnI + NotI (6.1kb + 4.9kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1389 A/G and 1782 A/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human DNMT1 Gene Plasmid Map
Human DNMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG11494-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"