Quick Order

Text Size:AAA

Human CPSF6 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CPSF6 cDNA Clone Product Information
NCBI RefSeq:NM_007007.2
RefSeq ORF Size:1656bp
cDNA Description:Full length Clone DNA of Homo sapiens cleavage and polyadenylation specific factor 6, 68kDa.
Gene Synonym:CFIM, CFIM68, HPBRII-4, HPBRII-7, CPSF6
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CPSF6
Restriction Site:KpnI + XbaI (6.1kb + 1.66kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CPSF6 Gene Plasmid Map
Human CPSF6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG11458-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"