After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CTRC natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CTRC cDNA Clone Product Information
Gene_bank_ref_id:NM_007272.2
RefSeq ORF Size:807bp
cDNA Description:Full length Clone DNA of Homo sapiens chymotrypsin C (caldecrin).
Gene Synonym:CLCR, ELA4, CTRC
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CTRC
Restriction Site:KpnI + XbaI (6.1kb + 0.81kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 144G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CTRC Gene Plasmid Map
Human CTRC Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Chymotrypsin C (abbreviated for CTRC), also known as caldecrin or elastase4, is a digestive enzyme of the peptidase S1 family. This enzyme is synthesized as an inactivate chymotrypsinogen. On cleavage by trypsin into two parts that activate each other by removing two small peptides in a trans-proteolysis, chymotrypsin C produced. N-linked glycosylation of human CTRC is required for efficient folding and secretion, however, the N-linked glycan is unimportant for enzyme activity or inhibitor binding. It has been proposed that CTRC is a key regulator of digestive zymogen activation and a physiological co-activator of digestive carboxypeptidases proCPA1 and proCPA2. Mutations that abolish activity or secretion of CTRC increase the risk for chronic pancreatitis. It's speculated that CTRC might regulate pancreatic cancer cell migration in relation to cytokeratin 18 expression. The pancreatic cancer cell migration ability was downregulated in pancreatic cancer Aspc-1 cells that overexpressed CTRC, whereas the cell migration ability was upregulated in Aspc-1 cells in which CTRC was suppressed. 

References
  • Lacruz RS, et al. (2011) Chymotrypsin C (caldecrin) is associated with enamel development. J Dent Res. 90 (10): 1228-33.
  • Zhou J, et al. (2011) Chymotrypsin C mutations in chronic pancreatitis. J Gastroenterol Hepatol. 26 (8): 1238-46.
  • Wang H, et al. (2011) Effect of chymotrypsin C and related proteins on pancreatic cancer cell migration. Acta Biochim Biophys Sin (Shanghai). 43 (5): 362-71.
  • Size / Price
    Catalog: HG11456-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"