After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CCR8 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CCR8 cDNA Clone Product Information
Gene_bank_ref_id:NM_005201.3
RefSeq ORF Size:1068bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-C motif) receptor 8.
Gene Synonym:CY6, TER1, CKRL1, CDw198, CKR-L1, CMKBR8, CMKBRL2, GPR-CY6, MGC129966, MGC129973, CCR8
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CCR8
Restriction Site:HindII + XbaI (6.1kb + 1.07kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CCR8 Gene Plasmid Map
Human CCR8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Size / Price
Catalog: HG11450-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"