Quick Order

Text Size:AAA

Human CCR8 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CCR8 cDNA Clone Product Information
Gene_bank_ref_id:NM_005201.3
RefSeq ORF Size:1068bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-C motif) receptor 8.
Gene Synonym:CY6, TER1, CKRL1, CDw198, CKR-L1, CMKBR8, CMKBRL2, GPR-CY6, MGC129966, MGC129973, CCR8
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CCR8
Restriction Site:HindII + XbaI (6.1kb + 1.07kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CCR8 Gene Plasmid Map
Human CCR8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Size / Price
Catalog: HG11450-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"