After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human NMNAT1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NMNAT1 cDNA Clone Product Information
Gene_bank_ref_id:NM_022787.3
RefSeq ORF Size:840bp
cDNA Description:Full length Clone DNA of Homo sapiens nicotinamide nucleotide adenylyltransferase 1.
Gene Synonym:NMNAT, PNAT1, NMNAT1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-NMNAT1
Restriction Site:HindIII + NotI (6.1kb + 0.84kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

NMNAT, also known as NMNAT1, is a member of the Nicotinamide-nucleotide adenylyltransferases. It is widely expressed with high levels in skeletal muscle, heart, liver and kidney. NMNAT appears to have the ability to protect against axonal degeneration following mechanical or toxic insults. The coenzyme NAD and its derivatives are involved in hundreds of metabolic redox reactions and are utilized in protein ADP-ribosylation, histone deacetylation, and in some Ca(2+) signaling pathways. NMNAT enzyme is vital for NAD biosynthesis, catalyzing the condensation of nicotinamide mononucleotide (NMN) or nicotinic acid mononucleotide (NaMN) with the AMP moiety of ATP to form NAD or NaAD.

References
  • Sugano S. et al., 1994, Gene. 138 (1-2): 171-4.
  • Saccucci F. et al., 2001, J Biol Chem. 276 (1): 406-12.
  • Hennig K. et al., 2001, FEBS Lett. 492 (1-2): 95-100.
  • Size / Price
    Catalog: HG11448-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"