After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human UBE2D1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human UBE2D1 cDNA Clone Product Information
Gene_bank_ref_id:NM_003338.3
RefSeq ORF Size:444bp
cDNA Description:Full length Clone DNA of Homo sapiens ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast).
Gene Synonym:SFT, UBCH5, UBC4/5, UBCH5A, E2(17)KB1, UBE2D1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-UBE2D1
Restriction Site:KpnI + XbaI (6.1kb + 0.44kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human UBE2D1 Gene Plasmid Map
Human UBE2D1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
References
  • Zhang L, et al. (2011) The IDOL-UBE2D complex mediates sterol-dependent degradation of the LDL receptor. Genes Dev. 25(12): 1262-74.
  • Tokumoto M, et al. (2011) Cadmium toxicity is caused by accumulation of p53 through the down-regulation of Ube2d family genes in vitro and in vivo. J Toxicol Sci. 36(2): 191-200.
  • Ohbayashi N, et al. (2008) Physical and functional interactions between ZIP kinase and UbcH5. Biochem Biophys Res Commun. 372(4): 708-12.
  • Gehrke SG, et al. (2003) UbcH5A, a member of human E2 ubiquitin-conjugating enzymes, is closely related to SFT, a stimulator of iron transport, and is up-regulated in hereditary hemochromatosis. Blood. 101(8): 3288-93.
  • Size / Price
    Catalog: HG11432-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"