Quick Order

Human TLR6 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TLR6 cDNA Clone Product Information
NCBI RefSeq:NM_006068.2
RefSeq ORF Size:2391bp
cDNA Description:Full length Clone DNA of Homo sapiens toll-like receptor 6.
Gene Synonym:CD286, TLR6
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-TLR6
Restriction Site:KpnI (two restriction sites) + XbaI (6.11kb+1.99kb+0.41kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1083 C>G and 1263 A>G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human TLR6 Gene Plasmid Map
Human TLR6 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: HG11428-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"