Quick Order

Human PMP2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PMP2 cDNA Clone Product Information
NCBI RefSeq:NM_002677.3
RefSeq ORF Size:399bp
cDNA Description:Full length Clone DNA of Homo sapiens peripheral myelin protein 2.
Gene Synonym:P2, MP2, FABP8, M-FABP, PMP2
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PMP2
Restriction Site:KpnI + XbaI (6.1kb + 0.4kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 186 A/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PMP2 Gene Plasmid Map
Human PMP2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Myelin P2 protein, also known as PMP2, is a cytosolic protein found primarily in peripheral nerves. It Belongs to the calycin superfamily. Fatty-acid binding protein (FABP) family. PMP2 is a small, basic, and cytoplasmic lipid binding protein of peripheral myelin. It is similar in amino acid sequence and tertiary structure to fatty acid binding proteins found in the liver, adipocytes, and intestine, its expression is limited to the nervous system. PMP2 is detected only in myelin-producing cells of the central and peripheral nervous systems, the oligodendrocytes and Schwann cells, respectively. PMP2 may play a role in lipid transport protein in Schwann cells. It forms a beta-barrel structure that accommodates hydrophobic ligands in its interior.

References
  • Hayasaka, K. et al., 1993, Genomics. 18 (2): 244-8.
  • Polverini, E. et al., 2006, J Struct Biol. 153 (3): 253-63.
  • Gould,R.M. et al., 2008, Neuron Glia Biol. 4 (2):137-52.
  • Size / Price
    Catalog: HG11426-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"