After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human SULT2B1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SULT2B1 cDNA Clone Product Information
Gene_bank_ref_id:NM_177973.1
RefSeq ORF Size:1098bp
cDNA Description:Full length Clone DNA of Homo sapiens sulfotransferase family, cytosolic, 2B, member 1.
Gene Synonym:HSST2, SULT2B1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-SULT2B1
Restriction Site:KpnI + XbaI (6.1kb + 1.1kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Sulfotransferase family cytosolic 2B member 1, also known as Sulfotransferase 2B1, ST2B1, Alcohol sulfotransferase, Hydroxysteroid sulfotransferase 2, SULT2B1 and HSST2, is a cytoplasm protein which belongs to the sulfotransferase 1 family. The human hydroxysteroid sulfotransferase (SULT) family is comprised of two subfamilies, SULT2A1 and SULT2B1. SULT2B1 is expressed highly in placenta, prostate and trachea. A lesser expression of SULT1B1 was observed in the small intestine and lung. SULT2B1 catalyzes the sulfate conjugation of many hormones, neurotransmitters, drugs and xenobiotic compounds. Sulfonation increases the water solubility of most compounds, and therefore their renal excretion, but it can also result in bioactivation to form active metabolites. SULT2B1 sulfates hydroxysteroids like DHEA. Isoform 1 preferentially sulfonates cholesterol. The two SULT2B1 isoforms, SULT2B1a and SULT2B1b, are encoded by a single gene as a result of alternative transcription initiation and alternative splicing. SULT2B1b catalyzes the sulfonation of 3beta-hydroxysteroid hormones and cholesterol, whereas SULT2B1a preferentially catalyzes pregnenolone sulfonation.

References
  • Fujita K. et al., 1997, J. Biochem. 122:1052-61.
  • Geese,WJ. et al., 2001,Biochem Biophys Res Commun.288 (1): 280-9.
  • Shimizu,C. et al., 2003, Endocrinology. 144 (4):1186-93.
  • Ji,Y. et al., 2007, J Pharmacol Exp Ther. 322 (2): 529-40.
  • Size / Price
    Catalog: HG11410-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"