After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTMAcDNA Clone Product Information
cDNA Size:336
cDNA Description:ORF Clone of Homo sapiens prothymosin, alpha DNA.
Gene Synonym:TMSA, MGC104802
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11407-ACG$325
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11407-ACR$325
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11407-ANG$325
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11407-ANR$325
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11407-CF$295
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11407-CH$295
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11407-CM$295
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11407-CY$295
Human PTMA Gene cDNA Clone (full-length ORF Clone)HG11407-M$95
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11407-M-F$295
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11407-M-N$295
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11407-NF$295
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11407-NH$295
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11407-NM$295
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11407-NY$295
Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11407-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

PTMA (prothymosin, alpha, N-GST chimera) is a small, 12.4 kDa protein. It is a 109-111 amino acid long polypeptide as the precursor of thymosin a1. Thymosins are named becaues they were originally isolated from the thymus. But now in many other tissues, thymosins also can be detected. Thymosins have diverse biological activities, and two in particular, thymosins a1 and _4, have potentially important uses in medicine, some of which have already progressed from the laboratory to the clinic. In general, PTMA is associated with cellular proliferation and carcinogenesis (Eschenfeldt et al., 1986), cellular and viral transcription (Cotter et al., 2000), protection against apoptosis and chromatin remodelling (Karetsou et al., 1998). PTMA may have a dual role both intracellulary and extracellulary. In relation to diseases, thymosins have been categorized as biological response modifiers. Thymosin a1 is derived from PTMA. For animals that lack thymus glands, thymosin a1 is responsible for the activity of that preparation in restoring immune function.

  • Manrow RE, et al. (1992) The human prothymosin alpha gene family contains several processed pseudogenes lacking deleterious lesions. Genomics. 13(2):319-31.
  • Wara DW, et al. (1975) Thymosin activity in patients with cellular immunodeficiency. N Engl J Med. 292(2):70-4.
  • Garaci E, et al. (2007) Thymosin alpha 1: from bench to bedside. Ann N Y Acad Sci. 1112:225-34.
  • Goldstein AL, et al. (2009) From lab to bedside: emerging clinical applications of thymosin alpha 1. Expert Opin Biol Ther. 9(5):593-608.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human PTMA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items