After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human NMNAT2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NMNAT2cDNA Clone Product Information
cDNA Size:924
cDNA Description:ORF Clone of Homo sapiens nicotinamide nucleotide adenylyltransferase 2 DNA.
Gene Synonym:PNAT2, C1orf15, MGC2756, KIAA0479, NMNAT2
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human NMNAT2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name

NMNAT2, also known as NMNAT-2, belongs to the nicotinamide mononucleotide adenylyltransferase (NMNAT) enzyme family. NMNAT is a central enzyme in NAD+ biosynthesis, transferring the adenylyl moiety of ATP to nicotinamide mononucleotide (NMN) or nicotinic acid mononucleotide (NaMN) resulting in the formation of NAD+ or NaAD+ and the release of pyrophosphate. NMNAT2 is predominantly expressed in human pancreas, insulinoma as well as in the brain, especially in the cerebrum, cerebellum, occipital lobe, frontal lobe, temporal lobe and putamen. Immunofluorescence microscopy localized endogenous NMNAT2 to the Golgi apparatus in human cell line. Endogenous NMNAT2 seem to be a labile axon survival factor, because specific depletion of NMNAT2 is sufficient to induce Wallerian-like degeneration of uninjured axons which endogenous NMNAT1 and NMNAT3 cannot prevent. Thus endogenous NMNAT2 represents an exciting new therapeutic target for axonal disorders.

  • Ljungberg MC. et al., 2012, Hum Mol Genet. 21 (2): 251-67.
  • Seki N. et al., 1998, DNA Res. 4 (5): 345-9.
  • Raffaelli N. et al., 2002, Biochem Biophys Res Commun. 297 (4): 835-40.
  • Sood R. et al., 2001, Genomics. 73 (2): 211-22.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human NMNAT2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items