After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CHST11 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CHST11 cDNA Clone Product Information
Gene_bank_ref_id:NM_018413.4
RefSeq ORF Size:1059bp
cDNA Description:Full length Clone DNA of Homo sapiens carbohydrate (chondroitin 4) sulfotransferase 11.
Gene Synonym:C4ST, C4ST1, C4ST-1, HSA269537, CHST11
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

CHST11, also known as C4ST-1, belongs to the sulfotransferase 2 family. CHST11 localizes to the golgi membrane, and catalyzes the transfer of sulfate to position 4 of the N-acetylgalactosamine (GalNAc) residue of chondroitin. Chondroitin sulfate constitutes the predominant proteoglycan present in cartilage, and is distributed on the surfaces of many cells and extracellular matrices. A chromosomal translocation involving CHST11 gene and IgH, t(12;14)(q23;q32), has been reported in a patient with B-cell chronic lymphocytic leukemia.

References
  • Hiraoka N. et al., 2000, J Biol Chem. 275 (26): 20188-96.
  • Schmidt HH. et al., 2004, Oncogene. 23 (41): 6991-6.
  • Okuda T. et al., 2001, J Biochem. 128 (5): 763-70.
  • Size / Price
    Catalog: HG11396-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"