Quick Order

Text Size:AAA

Human HSP90AB1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HSP90AB1 cDNA Clone Product Information
Gene_bank_ref_id:NM_007355.3
RefSeq ORF Size:2175bp
cDNA Description:Full length Clone DNA of Homo sapiens heat shock protein 90kDa alpha (cytosolic), class B member 1.
Gene Synonym:HSPC2, HSPCB, D6S182, HSP90B, FLJ26984, HSP90-BETA, HSP90AB1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-HSP90AB1
Restriction Site:KpnI (two restriction sites) + XbaI (6.11kb+1.64kb+0.54kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 741A>G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human HSP90AB1 Gene Plasmid Map
Human HSP90AB1 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: HG11381-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"