Quick Order

Human MGAT5 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MGAT5 cDNA Clone Product Information
Gene_bank_ref_id:NM_002410.3
RefSeq ORF Size:2226bp
cDNA Description:Full length Clone DNA of Homo sapiens mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase.
Gene Synonym:GNT-V, GNT-VA, MGAT5
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-MGAT5
Restriction Site:KpnI + XbaI (6.1kb + 2.23kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation: 1425 G/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human MGAT5 Gene Plasmid Map
Human MGAT5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase A, also known as Alpha-mannoside beta-1,6-N-acetylglucosaminyl-transferase, Mannoside acetylglucosaminyltransferase 5, N-acetylglucosaminyl-transferase V, MGAT5 and GGNT5, is a single-pass type I I membrane protein which belongs to the glycosyltransferase 18 family. MGAT5 / GGNT5 catalyzes the addition of N-acetylglucosamine in beta 1-6 linkage to the alpha-linked mannose of biantennary N-linked oligosaccharides. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. The central nervous system (CNS) is rich in glycoconjugates, located on cell surface and in extracellular matrix. MGAT5 / GGNT5 modification of complex-type N-glycans on CNS glycoproteins is involved in the regulation of depression-like behavior. Inhibitors of MGAT5 / GGNT5 might be useful in the treatment of malignancies by targeting their dependency on focal adhesion signaling for growth and metastasis.

References
  • Morgan,R. et al., 2004,J Immunol  173 (12): 7200-8.
  • Cheung,P. et al., 2007,Glycobiology  17 (7): 767-73.
  • Li,D. et al., 2008, J Immunol 180 (5): 3158-65.
  • Soleimani,L. et al., 2008, Genes Brain Behav. 7 (3):334-43.
  • Size / Price
    Catalog: HG11373-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"