After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human MDGA2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MDGA2cDNA Clone Product Information
cDNA Size:2871
cDNA Description:ORF Clone of Homo sapiens MAM domain containing glycosylphosphatidylinositol anchor 2 DNA.
Gene Synonym:MAMDC1, c14_5286, MDGA2
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Mouse MAM domain-containing glycosylphosphatidylinositol anchor protein 2, also known as MAM domain-containing protein 1, MDGA2 and MAMDC1, is a cell membrane protein which contains six Ig-like (immunoglobulin-like) domains and one MAM domain. Analyses of the full-length coding region of MDGA1 and MDGA2 indicate that they encode proteins that comprise a novel subgroup of the Ig superfamily and have a unique structural organization consisting of six immunoglobulin (Ig)-like domains followed by a single MAM domain. Biochemical characterization demonstrates that MDGA1 and MDGA2 proteins are highly glycosylated, and that MDGA1 is tethered to the cell membrane by a GPI anchor. The MDGAs are differentially expressed by subpopulations of neurons in both the central and peripheral nervous systems, including neurons of the basilar pons, inferior olive, cerebellum, cerebral cortex, olfactory bulb, spinal cord, and dorsal root and trigeminal ganglia. The similarity of MDGAs to other Ig-containing molecules and their temporal-spatial patterns of expression within restricted neuronal populations, for example migrating pontine neurons and D1 spinal interneurons, suggest a role for these novel proteins in regulating neuronal migration, as well as other aspects of neural development, including axon guidance.

  • Litwack,ED. et al., 2004, Mol Cell Neurosci. 25 (2): 263-74.
  • Hellquist, A. et al., 2009, PLoS One. 4 (12): e8037.
  • Sano,S. et al., 2009, Genesis. 47 (8):505-13.
  • Bucan, M. et al., 2009, PLoS Genet. 5 (6):e1000536.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items