After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human LGALS14 transcript variant 1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LGALS14 cDNA Clone Product Information
Gene_bank_ref_id:NM_020129.2
RefSeq ORF Size:420bp
cDNA Description:Full length Clone DNA of Homo sapiens lectin, galactoside-binding, soluble, 14, transcript variant 1.
Gene Synonym:CLC2, PPL13, MGC22235, LGALS14
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-LGALS14
Restriction Site:KpnI + XbaI (6.1kb + 0.42kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human LGALS14 Gene Plasmid Map
Human LGALS14 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Human LGALS14 transcript variant 1 natural ORF mammalian expression plasmid on other vectors
Product nameProduct name
Size / Price
Catalog: HG11371-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"