Quick Order

Text Size:AAA

Human MPC1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MPC1cDNA Clone Product Information
cDNA Size:330
cDNA Description:ORF Clone of Homo sapiens mitochondrial pyruvate carrier 1 DNA.
Gene Synonym:CGI-129, dJ68L15.3, BRP44L
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human MPC1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human MPC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11358-ACG$325
Human MPC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11358-ACR$325
Human MPC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11358-ANG$325
Human MPC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11358-ANR$325
Human MPC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11358-CF$295
Human MPC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11358-CH$295
Human MPC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11358-CM$295
Human MPC1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11358-CY$295
Human MPC1 Gene cDNA Clone (full-length ORF Clone)HG11358-M$95
Human MPC1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11358-M-F$295
Human MPC1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11358-M-N$295
Human MPC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11358-NF$295
Human MPC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11358-NH$295
Human MPC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11358-NM$295
Human MPC1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11358-NY$295
Human MPC1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11358-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability5 business days
  • Human MPC1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items