Quick Order

Text Size:AAA

Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DICER1cDNA Clone Product Information
cDNA Size:5769
cDNA Description:ORF Clone of Homo sapiens dicer 1, ribonuclease type I II DNA.
Gene Synonym:DCR1, Dicer, HERNA, KIAA0928, DICER1
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11350-ACG$645
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11350-ACR$645
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11350-ANG$645
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11350-ANR$645
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11350-CF$615
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11350-CH$615
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11350-CM$615
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11350-CY$615
Human DICER1 Gene cDNA Clone (full-length ORF Clone)HG11350-M$495
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11350-M-F$745
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11350-M-N$745
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11350-NF$615
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11350-NH$615
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11350-NM$615
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11350-NY$615
Human DICER1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11350-UT$615
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
List Price: $615.00  (Save $0.00)
Price:$615.00      [How to order]
Availability2-3 weeks