After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human MYC natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MYC cDNA Clone Product Information
Gene_bank_ref_id:NM_002467.3
RefSeq ORF Size:1365bp
cDNA Description:Full length Clone DNA of Homo sapiens v-myc myelocytomatosis viral oncogene homolog (avian).
Gene Synonym:c-Myc, bHLHe39, MYC
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein. It can help to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. Myc Tag also can be used to isolate protein complexes with multiple subunits. The Myc Tag Antibody is produced by the conjugation of a synthetic Myc tag peptide to KLH. Myc Tag Antibody can be used in various immunoassays, such as ELISA, Western blotting, immunoprecipitation, immunofluorescence, and more.

References
  • Ding X, et al., 2009, PLoS One. 4(6): e5949.
  • Ratsima H, et al., 2011, Proc Natl Acad Sci. 108(43): E914-23.
  • Chiang YJ, et al., 2013, PLoS One. 8(4): e61761.
  • Size / Price
    Catalog: HG11346-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"