Quick Order

Human HYOU1 / HSP12A natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HYOU1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001130991.1
RefSeq ORF Size:3000bp
cDNA Description:Full length Clone DNA of Homo sapiens hypoxia up-regulated 1.
Gene Synonym:Grp170, HSP12A, ORP150, FLJ94899, FLJ97572, DKFZp686N08236, HYOU1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-HSP12A
Restriction Site:HindIII + NotI (6.1kb + 3kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 2235A/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Hypoxia up-regulated protein 1, also known as 150 kDa oxygen-regulated protein, 170 kDa glucose-regulated protein, ORP-150, GRP-170 and HYOU1, is a member of the heat shock protein 70 family. Seven members from four different heat shock protein (HSP) families were identified including HYOU1 (ORP150), HSPC1 (HSP86), HSPA5 (Bip), HSPD1 (HSP60), and several isoforms of the two testis-specific HSP70 chaperones HSPA2 and HSPA1L. HYOU1 is highly expressed in tissues that contain well-developed endoplasmic reticulum and synthesize large amounts of secretory proteins. It is highly expressed in liver and pancreas. HYOU1 is also expressed in macrophages within aortic atherosclerotic plaques, and in breast cancers. HYOU1 has a pivotal role in cytoprotective cellular mechanisms triggered by oxygen deprivation. It may play a role as a molecular chaperone and participate in protein folding. Suppression of HYOU1 is associated with accelerated apoptosis. It is suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness.

Size / Price
Catalog: HG11342-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"