After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human HSPE1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HSPE1 cDNA Clone Product Information
Gene_bank_ref_id:NM_002157.2
RefSeq ORF Size:309bp
cDNA Description:Full length Clone DNA of Homo sapiens heat shock 10kDa protein 1 (chaperonin 10).
Gene Synonym:CPN10, GROES, HSP10, HSPE1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-HSPE1
Restriction Site:KpnI + NotI (6.1kb + 0.31kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human HSPE1 Gene Plasmid Map
Human HSPE1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG11330-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"