Quick Order

Human FUT8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
FUT8cDNA Clone Product Information
Gene Bank Ref.ID:NM_178154.1
cDNA Size:1728
cDNA Description:ORF Clone of Homo sapiens fucosyltransferase 8 (alpha (1,6) fucosyltransferase) DNA.
Gene Synonym:MGC26465, FUT8
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Human alpha (1,6) fucosyltransferase 8, also known as FUT8, is a member of the glycosyltransferase family. Fucosyltransferases are the enzymes transferring fucose from GDP-Fuc to Gal in an alpha1,2-linkage and to GlcNAc in alpha1,3-linkage, alpha1,4-linkage, or alpha1,6-linkage. All fucosyltransferases utilize the same nucleotide sugar, their specificity reside in the recognition of the acceptor and in the type of linkage formed. Fucosyltransferases share some common structural and catalytic features. On the basis of protein sequence similarities, these enzymes can be classified into four distinct families: (1) the alpha-2-fucosyltransferases, (2) the alpha-3-fucosyltransferases, (3) the mammalian alpha-6-fucosyltransferases, and (4) the bacterial alpha-6-fucosyltransferases. The alpha-3-fucosyltransferases constitute a distinct family as they lack the consensus peptide, but some regions display similarities with the alpha-2 and alpha-6-fucosyltranferases.

  • Breton C, et al. (1998) Conserved structural features in eukaryotic and prokaryotic fucosyltransferases. Glycobiology. 8(1): 87-94.
  • Oriol R, et al. (1999) Divergent evolution of fucosyltransferase genes from vertebrates, invertebrates, and bacteria. Glycobiology. 9(4): 323-34.
  • de Vries T, et al. (2001) Fucosyltransferases: structure / function studies. Glycobiology. 11(10): 119-128.
  • Baboval T, et al. (2002) Comparison of human and mouse Fuc-TX and Fuc-TXI genes, and expression studies in the mouse. Mamm Genome. 13(9): 538-41.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availsability:2-3 weeks