After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human IGSF3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IGSF3cDNA Clone Product Information
cDNA Size:3645
cDNA Description:ORF Clone of Homo sapiens immunoglobulin superfamily, member 3, transcript variant 2 DNA.
Gene Synonym:V8, EWI-3, MGC117164, IGSF3
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human IGSF3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name

Immunoglobulin superfamily member 3 (IGSF3), also known as Glu-Trp-Ile EWI motif-containing protein 3, IgSF3 and EWI-3 and IGSF3, is a single-pass type I membrane protein which belongs to the EWI subfamily of the Ig Superfamily of molecules. IGSF3 has an overall structural similarity and strong sequence similarity to V7, a human leukocyte surface protein. IGSF3 contains eight Ig-like C2-type (immunoglobulin-like) domains. IGSF3 is expressed in a wide range of tissues with high expression in Placenta, kidney and lung. EWI-2 is part of a novel Ig subfamily that includes EWI-F (F2alpha receptor regulatory protein (FPRP), CD9P-1 ), EWI-3 (IGSF3), and EWI-101 (CD101). All four members of this Ig subfamily contain a Glu-Trp-Ile (EWI) motif not seen in other Ig proteins. Human IGSF3 shares 92 % aa identity with mouse IGSF3.

  • Saupe S, et al. (1998) Molecular cloning of a human cDNA IGSF3 encoding an immunoglobulin-like membrane protein: expression and mapping to chromosome band 1p13. Genomics. 52(3): 305-11.
  • Lazaar AL, et al. (2001) VCAM-1 activates phosphatidylinositol 3-kinase and induces p120Cbl phosphorylation in human airway smooth muscle cells. J Immunol. 166(1): 155-61.
  • Wetzel A, et al. (2004) Human Thy-1 (CD90) on activated endothelial cells is a counterreceptor for the leukocyte integrin Mac-1 (CD11b/CD18). J Immunol. 172(6): 3850-9.
  • Size / Price
    List Price: $445.00  (Save $0.00)
    Price:$445.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items