Quick Order

Text Size:AAA

Human GPA33 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GPA33 cDNA Clone Product Information
Gene_bank_ref_id:NM_005814.1
RefSeq ORF Size:960bp
cDNA Description:Full length Clone DNA of Homo sapiens glycoprotein A33 (transmembrane).
Gene Synonym:A33, MGC129986, MGC129987, GPA33
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-GPA33
Restriction Site:KpnI + XbaI (6.1kb + 0.96kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human GPA33 Gene Plasmid Map
Human GPA33 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Cell surface A33 antigen, also known as glycoprotein A33, is a single-pass type I  membrane protein which is expressed in normal gastrointestinal epithelium and in 95% of colon cancers. GPA33 contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. The open reading frame encodes a 319-amino acid polypeptide having a putative secretory signal sequence and 3 potential glycosylation sites. The predicted mature protein has a 213-amino acid extracellular region, a single transmembrane domain, and a 62-amino acid intracellular tail. Intracellular traffic and recycling to the cell surface appear to play a major role in GPA33 function and to have an influence on its surface density superseding translational regulation. GPA33 has become a promising target of immunologic therapy strategies, but its biologic function and potential role in tumorigenesis are unknown. EpCAM protein and GPA33 mRNA expressions are specific and sensitive markers of Barrett's metaplasia (BM). GPA33 may also play a role in cell-cell recognition and signaling.

References
  • Heath J.K., et al., 1997, Proc. Natl. Acad. Sci. USA. 94:469-74.
  • Ritter G., et al., 1997, Biochem. Biophys. Res. Commun. 236:682-6.
  • Frey,D. et al., 2008, Cancer Biother Radiopharm  23 (1):65-73.
  • Rageul,J. et al., 2009, Int J Cancer 125 (12):2802-9. 
  • Size / Price
    Catalog: HG11277-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"