Quick Order

Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ACOX1cDNA Clone Product Information
cDNA Size:1983
cDNA Description:ORF Clone of Homo sapiens acyl-Coenzyme A oxidase 1, palmitoyl DNA.
Gene Synonym:ACOX, SCOX, MGC1198, PALMCOX, ACOX1
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11266-ACG$345
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11266-ACR$345
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11266-ANG$345
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11266-ANR$345
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11266-CF$315
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11266-CH$315
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11266-CM$315
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11266-CY$315
Human ACOX1 Gene cDNA Clone (full-length ORF Clone)HG11266-M$115
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11266-M-F$315
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11266-M-N$315
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11266-NF$315
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11266-NH$315
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11266-NM$315
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11266-NY$315
Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11266-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

Peroxisomal acyl-coenzyme A oxidase 1(ACOX1 or AOX) is the first enzyme of the fatty acid beta-oxidation pathway and belongs to the Acyl-CoA oxidase family. Human liver peroxisomes contain two acyl-CoA oxidases, namely, palmitoyl-CoA oxidase (ACOX1/AOX) and a branched chain acyl-CoA oxidase. The palmitoyl-CoA oxidase (ACOX1/AOX) oxidizes the CoA esters of straight chain fatty acids and prostaglandins and donates electrons directly to molecular oxygen, thereby producing H2O2. Human ACOX1/AOX is a protein of 661-amino acids, including the carboxyl-terminal sequence(Ser-Lys-Leu) known as a minimal peroxisome-targeting signal. Human ACOX1/AOX, the first and rate-limiting enzyme of the peroxisomal β-oxidation pathway, has two isoforms including ACOX1a and ACOX1b, transcribed from a single gene. The human ACOX1b isoform is more effective than the ACOX1a isoform in reversing the Acox1 null phenotype in the mouse partly because of the Substrate utilization differences.

  • Vluggens A, et al. (2010) Functional significance of the two ACOX1 isoforms and their crosstalks with PPAR alpha and RXR alpha. Laboratory Investigation. 90: 696-708.
  • Chu R, et al. (1995) Overexpression and characterization of the human peroxisomal acyl-CoA oxidase in insect cells. J Biol Chem. 270 (9): 4908-15.
  • Aoyama T, et al. (1994) Molecular cloning and functional expression of a human peroxisomal acyl-coenzyme A oxidase. Biochem Biophys Res Commun. 198 (3): 1113-8.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability5 business days
    • Human ACOX1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged