Quick Order

Human PRDX5 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PRDX5 cDNA Clone Product Information
Gene_bank_ref_id:NM_012094.4
RefSeq ORF Size:645bp
cDNA Description:Full length Clone DNA of Homo sapiens peroxiredoxin 5.
Gene Synonym:PLP, ACR1, B166, PRXV, PMP20, PRDX6, SBBI10, AOEB166, MGC117264, MGC142283, MGC142285, PRDX5
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-PRDX5
Restriction Site:KpnI + XbaI (6.1kb + 0.65kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Peroxiredoxin-5, also known as Alu corepressor 1, Antioxidant enzyme B166, Liver tissue 2D-page spot 71B, Peroxisomal antioxidant enzyme, Thioredoxin peroxidase PMP20, Thioredoxin reductase, PRDX5 and ACR1, is cytoplasm protein which belongs to the?peroxiredoxin 2 family. Peroxiredoxin-5 / PRDX5 reduces hydrogen peroxide and alkyl hydroperoxides with reducing equivalents provided through the thioredoxin system. Peroxiredoxin-5 / PRDX5 is involved in intracellular redox signaling. The Peroxiredoxins / Prx are a family of 25 kDa peroxidases that can reduce H2O2 using an electron from thioredoxin (Trx) or other substances. The mammalian Peroxiredoxins / Prx family is divided into six groups ( PRDX1,PRDX2, PRDX3, PRDX4, PRDX5, PRDX6 ) on the basis of homology of amino acid sequences. They are located in the cytosol and play a role in the cell signaling system. All six mammalian peroxiredoxins are expressed in the lung. Peroxiredoxins / Prx is overexpressed in breast cancer tissues to a great extent suggesting that Peroxiredoxins / Prx has a proliferative effect and may be related to cancer development or progression.

References
  • Seo M.S., et al., 2000, J. Biol. Chem. 275: 20346-54.
  • Declercq J.-P., et al., 2001, J. Mol. Biol. 311:751-9.
  • Noh,D.Y. et al., 2001, Anticancer Res. 21 (3B): 2085-90.
  • Schremmer,B. et al., 2007, Subcell Biochem. 44 :317-44.
  • Size / Price
    Catalog: HG11263-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"