Quick Order

Text Size:AAA

Human RGS17 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RGS17 cDNA Clone Product Information
Gene_bank_ref_id:NM_012419.4
RefSeq ORF Size:633bp
cDNA Description:Full length Clone DNA of Homo sapiens regulator of G-protein signaling 17.
Gene Synonym:RGSZ2, RGS-17, hRGS17, RGS17
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-RGS17
Restriction Site:KpnI + XbaI (6.1kb + 0.63kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human RGS17 Gene Plasmid Map
Human RGS17 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG11248-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"