Quick Order

Text Size:AAA

Human ATP6AP2 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ATP6AP2 cDNA Clone Product Information
Gene_bank_ref_id:NM_005765.2
RefSeq ORF Size:1053bp
cDNA Description:Full length Clone DNA of Homo sapiens ATPase, H+ transporting, lysosomal accessory protein 2.
Gene Synonym:M8-9, MRXE, XMRE, HT028, ELDF10, ATP6IP2, MSTP009, APT6M8-9, ATP6M8-9, MGC99577, ATP6AP2
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ATP6AP2
Restriction Site:KpnI + XbaI (6.1kb + 1.05kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ATP6AP2 Gene Plasmid Map
Human ATP6AP2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG11244-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"