Quick Order

Human BIK Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BIKcDNA Clone Product Information
Gene_bank_ref_id:NM_001197.3
cDNA Size:483
cDNA Description:ORF Clone of Homo sapiens BCL2-interacting killer (apoptosis-inducing) DNA.
Gene Synonym:BP4, NBK, BIP1, BIK
Species:Human
Vector:pCMV3-untagged
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human BIK Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name
Background

The BIN1 protein, which is encoded by the BIN1 gene, belongs to Myc-interacting protein family which is one of the nucleocytoplasmic adaptor proteins. The BIN1 protein can interact with the functionally critically Myc-box region at the N-terminal of the Myc oncoprotein, with a feature of tumor suppressor. Myc family proteins promote proliferation, growth, and apoptosis and, when deregulated, are profoundly involved in the genesis of an extraordinarily wide range of cancers. Although BIN1 is expressed in many normal cells, its levels were greatly reduced or undetectable in 14/27 carcinoma cell lines and 3/6 primary breast tumours. Deficits were functionally Although BIN1 is expressed in many normal cells, its levels were greatly reduced or undetectable in 14/27 carcinoma cell lines and 3/6 primary breast tumours. Deficits were functionally significant because ectopic expression of BIN1 inhibited the growth of tumour cells lacking endogenous message. We conclude that BIN1 is an MYC-interacting protein with features of a tumour suppressor.

Size / Price
Catalog:HG11239-UT
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability5 business days
Images
  • Human BIK Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"