Quick Order

Text Size:AAA

Human PRDM2 / RIZ1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRDM2cDNA Clone Product Information
cDNA Size:1514
cDNA Description:ORF Clone of Homo sapiens PR domain containing 2, with ZNF domain DNA.
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human PRDM2 / RIZ1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name

PR domain containing 2, with ZNF domain (PRDM2), also known as zinc finger protein RIZ, is a member of histone methyltransferase (HMT) class enzymes that methylate lysine residues of histones or proteins. HMTs contain a conserved catalytic core termed the SET domain, which shares sequence homology with an independently described sequence motif, the PR domain. PRDM2 contains 8 C2H2-type zinc fingers and a distinct SET domain, and is highly expressed in retinoblastoma cell lines and in brain tumors, as well as in a number of other cell lines and in brain, heart, skeletal muscle, liver and spleen. PRDM2 is a S-adenosyl-L-methionine-dependent histone methyltransferase that specifically methylates 'Lys-9' of histone H3, and is identified as a tumor suppressor. It is reported that intact PR( SET) sequence is required for tumor suppression functions, mutations in the PR domain caused activity reduction in human cancers. Also, S-adenosylhomocysteine or methyl donor deficiency inhibits RIZ1 and other H3 lysine 9 methylation activities. PRDM2 may also function as a DNA-binding transcription factor. It Binds to the macrophage-specific TPA-responsive element (MTE) of the HMOX1 (heme oxygenase 1) gene and act as a transcriptional activator. In addition, PRDM2 (RIZ) is able to binds to the retinoblastoma protein (RB) and also Interacts with GATA3.

  • Buyes, I.M. et al., 1995, Proc. Natl. Acad. Sci. U.S.A. 92: 4467-4471.
  • Muraosa, Y. et al., 1996, Eur. J. Biochem. 235: 471-479.
  • Kim, K. et al., 2003, Cancer. Res. 63: 7619-7623.
  • Shapiro, V.S. et al., 1995, Gene. 163: 329-330.
  • Briknarova, K.et al.,2008,Biochem.Biophys.Res.Commun.366:807-813.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items