Quick Order

Text Size:AAA

Human PRMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRMT1cDNA Clone Product Information
cDNA Size:1116
cDNA Description:ORF Clone of Homo sapiens protein arginine methyltransferase 1 DNA.
Gene Synonym:ANM1, HCP1, IR1B4, HRMT1L2, PRMT1
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human PRMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human PRMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11210-ACG$325
Human PRMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11210-ACR$325
Human PRMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11210-ANG$325
Human PRMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11210-ANR$325
Human PRMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11210-CF$295
Human PRMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11210-CH$295
Human PRMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11210-CM$295
Human PRMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11210-CY$295
Human PRMT1 Gene cDNA Clone (full-length ORF Clone)HG11210-M$95
Human PRMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11210-M-F$295
Human PRMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11210-M-N$295
Human PRMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11210-NF$295
Human PRMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11210-NH$295
Human PRMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11210-NM$295
Human PRMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11210-NY$295
Human PRMT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11210-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name