Quick Order

Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SETD7cDNA Clone Product Information
Gene_bank_ref_id:NM_030648.2
cDNA Size:1101
cDNA Description:ORF Clone of Homo sapiens SET domain containing (lysine methyltransferase) 7 DNA.
Gene Synonym:KMT7, SET7, SET9, SET7/9, FLJ21193, KIAA1717, SETD7
Species:Human
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11209-ACG$325
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11209-ACR$325
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11209-ANG$325
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11209-ANR$325
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11209-CF$295
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11209-CH$295
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11209-CM$295
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11209-CY$295
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone)HG11209-M$195
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11209-M-F$395
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11209-M-N$395
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-taggedHG11209-M-Y$395
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11209-NF$295
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11209-NH$295
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11209-NM$295
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11209-NY$295
Human SETD7 / SET7 / 9 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11209-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Histone-lysine N-methyltransferase SETD7, also known as SET domain containing (lysine methyltransferase) 7, SET7/9, Histone H3-K4 methyltransferase SETD7, H3-K4-HMTase SETD7, and SETD7, is a member of the histone-lysine methyltransferase family and SET7 subfamily. SETD7 is widely expressed and expressed in pancreatic islets. SETD7 contains three MORN repeats and one SET domain. SETD7 plays a central role in the transcriptional activation of genes such as collagenase or insulin. As a protein lysine methyltransferase (PKMT), SETD7 also has methyltransferase activity toward non-histone proteins such as p53/TP53, TAF10, and possibly TAF7 by recognizing and binding in substrate proteins. The mono-methyltransferase activity of SETD7 is achieved by disrupting the formation at near-attack conformations for the dimethylation reaction. SETD7 is also a novel coactivator of NF-kappaB and plays a role in inflammation and diabetes.

References
  • Wang, H. et al., 2002, Mol Cell 8 (6): 1207-17. 
  • Jacobs, SA. et al., 2002, Nat. Struct. Biol. 9 (11): 833-8. 
  • Xiao B, et al., 2003, Nature. 421 (6923): 652-6.
  • Martens, JH. et al., 2003, Mol. Cell. Biol. 23: 1808-1816.
  • Couture, JF. et al., 2006, Nat Struct Mol Biol  13 (2): 140-6.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"