Quick Order

Human HPGD transcript variant 1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HPGD cDNA Clone Product Information
Gene_bank_ref_id:NM_000860.4
RefSeq ORF Size:801bp
cDNA Description:Full length Clone DNA of Homo sapiens hydroxyprostaglandin dehydrogenase 15-(NAD), transcript variant 1.
Gene Synonym:PGDH, PGDH1, 15-PGDH, SDR36C1, HPGD
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-HPGD
Restriction Site:KpnI + XbaI (6.1kb + 0.8kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human HPGD Gene Plasmid Map
Human HPGD transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Mouse 15-hydroxyprostaglandin dehydrogenase [NAD+], also known as Prostaglandin dehydrogenase 1, HPGD, and PGDH1, is a member of the short-chain dehydrogenases/reductases (SDR) family. Prostaglandins (PGs) play a key role in the onset of labor in many species and regulate uterine contractility and cervical dilatation. Therefore, the regulation of prostaglandin output by PG synthesizing and metabolizing enzymes in the human myometrium may determine uterine activity patterns in human labor both at preterm and at term. Prostaglandin dehydrogenase (PGDH) metabolizes prostaglandins (PGs) to render them inactive. HPGD is down-regulated by cortisol, dexamethasone and betamethasone and down-regulated in colon cancer. It is up-regulated by TGFB1. HPGD contributes to the regulation of events that are under the control of prostaglandin levels. HPGD catalyzes the NAD-dependent dehydrogenation of lipoxin A4 to form 15-oxo-lipoxin A4. and inhibits in vivo proliferation of colon cancer cells. Defects in HPGD are the cause of primary hypertrophic osteoathropathy autosomal recessive (PHOAR) , cranioosteoarthropathy (COA), and isolated congenital nail clubbing.

References
  • Patel, FA. et al., 2003, J. Clin. Endocrinol. Metab. 88: 2922-33.
  • McKeown KJ, et al.,2003, J. Clin. Endocrinol. Metab. 88 (4): 1737-41.
  • Yan, M. et al., 2004, Proc. Natl. Acad. Sci. USA. 101: 17468-73.
  • Tariq, M. et al., 2009, J Med Genet. 46 (1): 14-20.
  • Size / Price
    Catalog: HG11205-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"