Quick Order

Human CRABP2 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CRABP2 cDNA Clone Product Information
NCBI RefSeq:NM_001878.2
RefSeq ORF Size:417bp
cDNA Description:Full length Clone DNA of Homo sapiens cellular retinoic acid binding protein 2.
Gene Synonym:RBP6, CRABP-II, CRABP2
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CRABP2
Restriction Site:KpnI + XbaI (6.1kb + 0.42kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CRABP2 Gene Plasmid Map
Human CRABP2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Mouse cellular retinoic acid-binding protein 2, also known as Cellular retinoic acid-binding protein II, CRABP-II and CRABP2, is a protein which belongs to the calycin superfamily and Fatty-acid binding protein (FABP) family. Cellular retinoic acid binding proteins (CRABP) are low molecular weight proteins whose precise function remains unknown. The predicted amino acid sequences of human CRABP1 and CRABP2 demonstrated a 99.3% and 93.5% identity to mouse CRABP1 and CRABP2, respectively. CRABP2 forms a beta-barrel structure that accommodates hydrophobic ligands in its interior. Expression of CRABP2, but not CRABP1 mRNA, was markedly increased (greater than 15-fold) by retinoic acid treatment of fibroblasts cultured from human skin, whereas no significant induction of CRABP2 mRNA was observed in human lung fibroblasts. CRABP2 transports retinoic acid to the nucleus. It regulates the access of retinoic acid to the nuclear retinoic acid receptors. CRABP2 is necessary for elastin induction by All-trans retinoic acid (ATRA) in MRC-5 cells. It is expressed at low levels in emphysema fibroblasts. This alteration in the retinoic acid signalling pathway in lung fibroblasts may contribute to the defect of alveolar repair in human pulmonary emphysema.

References
  • Deak,KL.et al., 2005,Birth Defects Res A Clin Mol Teratol.73 (11): 868-75.
  • Plantier, L. et al., 2008, Thorax  63 (11): 1012-7.
  • Calmon, M.F. et al., 2009, Neoplasia  11 (12): 1329-39.
  • Welch, I.D. et al., 2009, Arthritis Res Ther  11 (1): R14.
  • Size / Price
    Catalog: HG11203-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"