Quick Order

Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CSRP1cDNA Clone Product Information
cDNA Size:582
cDNA Description:ORF Clone of Homo sapiens cysteine and glycine-rich protein 1 DNA.
Gene Synonym:CRP, CRP1, CSRP, CYRP, D1S181E, DKFZp686M148, CSRP1
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11201-ACG$325
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11201-ACR$325
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11201-ANG$325
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11201-ANR$325
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11201-CF$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11201-CH$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11201-CM$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11201-CY$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone)HG11201-M$95
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11201-M-F$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11201-M-N$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11201-NF$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11201-NH$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11201-NM$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11201-NY$295
Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11201-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Mouse Cysteine and glycine-rich protein 1, also known as Cysteine-rich protein 1, CSRP1 and CSRP, is a member of the CSRP family which may be involved in regulatory processes important for development and cellular differentiation. CSRP1 contains two LIM zinc-binding domains. The LIM / double zinc-finger motif found in CSRP1 is found in a group of proteins with critical functions in gene regulation, cell growth, and somatic differentiation. Zebrafish CSRP1 is expressed in the mesendoderm and its derivatives. CSRP1 interacts with Dishevelled 2 (Dvl2) and Diversin (Div), which control cell morphology and other dynamic cell behaviors via the noncanonical Wnt and JNK pathways. When CSRP1 message is knocked down, abnormal convergent extension cell movement is induced, resulting in severe deformities in midline structures. In addition, cardiac bifida is induced as a consequence of defects in cardiac mesoderm cell migration. CSRP1 acts as a key molecule of the noncanonical Wnt pathway, which orchestrates cell behaviors during dynamic morphogenetic movements of tissues and organs.

  • Wimmer,U. et al., 2005, Nucleic acids Res. 33 (18):5715-27.
  • Miyasaka, KY.et al., 2007, Proc Natl Acad Sci USA. 104 (27): 11274-9.
  • Zhou,C.Z. et al., 2008,Chin Med J. 121 (24): 2479-86.
  • Lilly,B. et al., 2010, Arterioscler Thromb Vasc Biol. 30 (4):694-701. 
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human CSRP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items