Quick Order

Human SMYD2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SMYD2cDNA Clone Product Information
cDNA Size:1302
cDNA Description:ORF Clone of Homo sapiens SET and MYND domain containing 2 DNA.
Gene Synonym:KMT3C, HSKM-B, ZMYND14, MGC119305, SMYD2
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human SMYD2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human SMYD2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11093-ACG$325
Human SMYD2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11093-ACR$325
Human SMYD2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11093-ANG$325
Human SMYD2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11093-ANR$325
Human SMYD2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11093-CF$295
Human SMYD2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11093-CH$295
Human SMYD2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11093-CM$295
Human SMYD2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11093-CY$295
Human SMYD2 Gene cDNA Clone (full-length ORF Clone)HG11093-M$195
Human SMYD2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11093-M-F$395
Human SMYD2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11093-M-N$395
Human SMYD2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11093-NF$295
Human SMYD2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11093-NH$295
Human SMYD2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11093-NM$295
Human SMYD2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11093-NY$295
Human SMYD2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11093-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

SET and MYND domain-containing protein 2, also known as HSKM-B, SMYD2, and KMT3C, is a member of the SMYD protein family. It contains one MYND-type zinc finger and one SET domain. Not much is known about SMYD2. However, the interest in better understanding the roles of SMYD2 has grown because of reports indicating that SMYD2 methylates p53 and histone H3. In Xenopus, SMYD1 and SMYD2 were expressed in various muscle tissues and related to muscle cells differentiation. SMYD2 mRNA is most highly expressed in heart and brain tissue. Over-expressed SMYD2 localizes to the cytoplasm and the nucleus in 293T cells. SMYD2 appears to restrain cell proliferation, likely through direct modulation of chromatin structure. Patients with SMYD2-overexpressing tumors had a worse overall rate of survival than those with non-expressing tumors, and SMYD2 positivity was independently associated with a worse outcome in the multivariate analysis. SMYD2 plays an important role in tumor cell proliferation through its activation/overexpression and regards as a prognosticator and potential therapeutic target in esophageal squamous cell carcinoma (ESCC).