After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BIRC2cDNA Clone Product Information
Gene_bank_ref_id:NM_001166.3
cDNA Size:1857
cDNA Description:ORF Clone of Homo sapiens baculoviral IAP repeat-containing 2 DNA.
Gene Synonym:API1, MIHB, HIAP2, RNF48, cIAP1, Hiap-2
Species:Human
Vector:pCMV3-untagged
Restriction Site:HindIII + NotI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11090-ACG$345
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11090-ACR$345
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11090-ANG$345
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11090-ANR$345
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11090-CF$315
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11090-CH$315
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11090-CM$315
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11090-CY$315
Human BIRC2 Gene cDNA Clone (full-length ORF Clone)HG11090-M$115
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11090-M-F$315
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11090-M-N$315
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11090-NF$315
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11090-NH$315
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11090-NM$315
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11090-NY$315
Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11090-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

The cellular inhibitor of apoptosis protein-1 (cIAP1) is a member of the Inhibitor of Apoptosis family proteinsare (IAP) whose members are characterized by a novel domain of about 70 amino acids termed baculoviral IAP repeats (BIRs). The BIR domains of cIAP1 and cIAP2 bind to caspases, the key effector proteases of apoptosis. The IAP protein family which can enhance cell survival are crucial regulators of programmed cell death. Both cIAP1 and cIAP2 are the E3 ubiquitin protein isopeptide ligases for Smac, taking part in promoting cancer survival through functioning as E3 ubiqitin ligases. Removal of cIAP1 by genetic deletion may result in NF-κB signaling activation that induces TNFα production and in killing sensitive tumor cells through enhanced TNF-R1 death-receptor signaling and caspase 8 activation. The substrate-dependent E3 activity of cIAPs is mediated by their RING domains and is dependent on the specific interactions between cIAPs and Smac. cIAP1 and cIAP2 are also reported to be regulators of NF-kB activation upon TNFαtreatment.

References
  • Vince JE, et al. (2007) IAP Antagonists Target cIAP1 to Induce TNF-Dependent Apoptosis. Cell. 131(4): 682-93.
  • Hu SM, et al. et al. (2003) Cellular Inhibitor of Apoptosis 1 and 2 Are Ubiquitin Ligases for the Apoptosis Inducer Smac/DIABLO. The Journal of Biological Chemistry. 278: 10055-60.
  • Imoto I, et al. (2011) Identification of cIAP1 As a Candidate Target Gene within an Amplicon at 11q22 in Esophageal Squamous Cell Carcinomas 1. Cancer Res. 61: 6629.
  • Size / Price
    Catalog:HG11090-UT
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability5 business days
    Images
    • Human BIRC2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"