Quick Order

Human VLDLR natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human VLDLR cDNA Clone Product Information
Gene_bank_ref_id:NM_003383.3
RefSeq ORF Size:2622bp
cDNA Description:Full length Clone DNA of Homo sapiens very low density lipoprotein receptor.
Gene Synonym:CHRMQ1, VLDLRCH, FLJ35024, VLDLR
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-VLDLR
Restriction Site:KpnI + XbaI (6.1kb + 2.62kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

The very low density lipoprotein receptor, known as VLDLR, is a single-pass type 1 integral membrance protein and a member of the LDL receptor family. This receptor family includes LDL receptor, LRP, megalin, VLDLR and ApoER2, and is characterized by a cluster of cysteine-rich class A repeats, epidermal growth factor (EGF)-like repeats, YWTD repeats and an O-linked sugar domain. VLDLR contains 3 EGF-like domains, 8 LDL-receptor class A domains, as well as 6 LDL-receptor class B repeats, and is abundant in heart, skeletal muscle, also ovary and kidney, but not in liver. VLDLR binds VLDL and transports it into cells by endocytosis. In order to be internalized, the receptor-ligand complexes must first cluster into clathrin-coated pits. VLDLR mediates the phosphorylation of mDab1 (mammalian disabled protein) via binding to Reelin, and induces the modulation of Tau phosphorylation. This pathway regulates the migration of neurons along the radial glial fiber network during brain development. Defects of VLDLR may be the cause of VLDLR-associated cerebellar hypoplasia (VLDLRCH), a syndrome characterized by moderate-to-profound mental retardation, delayed ambulation, and predominantly truncal ataxia.

References
  • Trommsdorff, M. et al., 1999. Cell. 97: 689-701.
  • Mikhailenko, I. et al., 1999. J. Cell Sci. 112: 3269-3281.
  • Sato, A. et al., 1999. Biochem. J. 341: 377-383.
  • Hiesberger, T. et al., 1999. Neuron 24: 481-489.
  • Tiebel, O. et al., 1999. Atherosclerosis 145: 239-251.
  • Boycott, K.M. et al., 2005, Am. J. Hum. Genet. 77 (3): 477-483. 
  • Moheb, L.A. et al., 2008, Eur. J. Hum. Genet. 16 (2): 270-273.
  • Size / Price
    Catalog: HG11075-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"