Quick Order

Human PRMT5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRMT5cDNA Clone Product Information
cDNA Size:1914
cDNA Description:ORF Clone of Homo sapiens protein arginine methyltransferase 5 DNA.
Gene Synonym:JBP1, SKB1, IBP72, SKB1Hs, HRMT1L5, PRMT5
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 241 C/T and 429 C/T not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name

Methylation of arginine residues is a widespread post-translational modification of proteins catalyzed by a small family of PRMTs. The modification appears to regulate protein functions and interactions that affect gene regulation, signalling and subcellular localization of proteins and nucleic acids. Protein arginine methyltransferase 5 (PRMT5) is a member of the protein arginine N-methyltransferases (PRMT)family, and exists as at least homodimers and homotetramers, or homooligomers mediated by disulfide bonds and non-covalent association ubiquitously. PRMT5 specifically mediates the symmetrical dimethylation of arginine residues in the small nuclear ribonucleoproteins Sm D1 (SNRPD1) and Sm D3 (SNRPD3), and thus plays a role in the assembly and biogenesis of snRNP core particles. PRMT5 methylates histone H2A and H4 'Arg-3' during germ cell development, as well as histone H3 'Arg-8', which may repress transcription. PRMT5 also methylates SUPT5H and regulates its transcriptional elongation properties. Additionally, it is also suggested that PRMT5 negatively regulates cyclin E1 promoter activity and cellular proliferation.

  • Rho. J. et al., 2001, J.Biol. Chem. 276: 11393-11401.
  • Fabbrizio, E.et al., 2002, EMBO.Rep. 3: 641-645.
  • Azzouz, T.N. et al., 2005, J.Biol. Chem. 280: 34435-34440.
  • Pal, S., et al., 2004, Mol. Cell. Biol. 24:9630-9645.
  • Herrmann, FJ. et al., 2009, Cell Sci. 122 (Pt 5): 667-77.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability5 Business days
      Recently Viewed Items