Quick Order

Human GFPT1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GFPT1 cDNA Clone Product Information
Gene_bank_ref_id:NM_002056.2
RefSeq ORF Size:2046bp
cDNA Description:Full length Clone DNA of Homo sapiens glutamine-fructose-6-phosphate transaminase 1.
Gene Synonym:GFA, GFAT, GFPT, GFAT1, GFAT1m, GFPT1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Glutamine:fructose-6-phosphate amidotransferase 1 (GFAT), also known as GFPT1, is a member of the N-terminal nucleophile aminotransferases and the first rate-limiting enzyme for the entry of glucose into the hexosamine biosynthesis pathway (HBP) in mammals. GFAT transfers the amino group from the L-glutamine amide to the D-fructose 6-phosphate, producing glutamic acid and glucosamine 6-phosphate. GFAT exists as a homotetramer in cytoplasm, and is proposed to be most likely involved in regulating the availability of precursors for N- and O-linked glycosylation of proteins. The full length of human GFAT contains 1 glutamine amidotransferase type-2 domain which catalyzes amide nitrogen transfer from glutamine to the appropriate substrate, and 2 SIS (Sugar Isomerase) domains found in many phosphosugar isomerases and phosphosugar binding proteins.Two isoforms of gfat have been identified: GFAT1 is predominantly expressed in skeletal muscle, whereas GFAT2 is expressed mainly in the central nervous system.

Size / Price
Catalog: HG11071-UT
List Price:   (Save )
Price:      [How to order]
Availability4-5 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"