Quick Order

Text Size:AAA

Human SCARB1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SCARB1cDNA Clone Product Information
Gene_bank_ref_id:NM_005505.4
cDNA Size:1529
cDNA Description:ORF Clone of Homo sapiens scavenger receptor class B, member 1 DNA.
Gene Synonym:CLA1, SRB1, CLA-1, SR-BI, CD36L1, MGC138242, SCARB1
Species:Human
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Scavenger receptor class B, member 1 (SCARB1), also known as CD36L1, is a member of the scavenger receptor family. SCARB1 is expressed primarily in liver and non placental steroidogenic tissues, and predominantly localized to cholesterol and sphingomyelin-enriched domains within the plasma membrane. SCARB1 is proposed as a receptor for different ligands such as phospholipids, cholesterol ester, lipoproteins, phosphatidylserine and apoptotic cells, and is involved in a wide variety of physilogical processes. As a key component in the reverse cholesterol transport pathway, SCARB1 binds high density lipoproteins (HDLs) and mediates selective cholesterol uptake by a mechanism distinct from the LDL pathway. High density lipoproteins (HDLs) play a critical role in cholesterol metabolism and their plasma concentrations are inversely correlated with risk for atherosclerosis. SCARB1 may thus serve as a useful marker that predicts variation in baseline lipid levels and postprandial lipid response. The mouse SCARB1 has been shown to exert actions in determining the levels of plasma lipoprotein cholesterol and the accumulation of cholesterol stores in the adrenal gland.

References
  • Murao, K. et al., 1997, J. Biol. Chem. 272(28): 17551-17557.
  • Ikemoto, M. et al., 2000, Proc. Natl. Acad. Sci. U.S.A. 97 (12): 6538-6543.
  • Husemann, J. et al., 2001, Am. J. Pathol. 158 (3): 825-832. 
  • Williams, D.L. et al., 2001, Endocr. Res. 26 (4): 639-651.
  • Bulte, B. S. et al., 2002, J. Biol. Chem. 277 (39): 36092-36099.
  • Duncan, K.G. et al., 2002, Biochem. Biophys. Res. Commun. 292 (4): 1017-1022. 
  • Size / Price
    Catalog:HG11069-UT
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"