Quick Order

Human CHST15 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CHST15 cDNA Clone Product Information
NCBI RefSeq:NM_015892.2
RefSeq ORF Size:1686bp
cDNA Description:Full length Clone DNA of Homo sapiens carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15.
Gene Synonym:KIAA0598, MGC34346, RP11-47G11.1, DKFZp781H1369
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CHST15
Restriction Site:KpnI + XbaI (6.1kb + 1.69kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CHST15 Gene Plasmid Map
Human CHST15 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Carbohydrate sulfotransferase 15, also known as N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase, GalNAc4S-6ST, B-cell RAG-associated gene protein, CHST15 and BRAG, is a single-pass type I I membrane protein which belongs to the sulfotransferase 1 family. CHST15 / BRAG is expressed in B-cell-enriched tissues but not in fetal or adult thymus. It is expressed in fetal and adult spleen, lymph node, tonsil, bone marrow and peripheral leukocytes. It is not expressed in T-cells. In pro-B, pre-B, and mature B-cell lines, it colocalizes with RAG1. CHST15 / BRAG is a sulfotransferase that transfers sulfate from 3'-phosphoadenosine 5'-phosphosulfate (PAPS) to the C-6 hydroxyl group of the GalNAc 4-sulfate residue of chondroitin sulfate A and forms chondroitin sulfate E containing GlcA-GalNAc(4,6-SO4) repeating units. It also transfers sulfate to a unique non-reducing terminal sequence, GalNAc(4SO4)-GlcA(2SO4)-GalNAc(6SO4), to yield a highly sulfated structure similar to the structure found in thrombomodulin chondroitin sulfate. CHST15 / BRAG may also act as a B-cell receptor involved in BCR ligation-mediated early activation that mediate regulatory signals key to B-cell development and / or regulation of B-cell-specific RAG expression.

Size / Price
Catalog: HG11033-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"