Quick Order

Human CD24 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD24cDNA Clone Product Information
cDNA Size:243
cDNA Description:ORF Clone of Homo sapiens CD24 molecule DNA.
Gene Synonym:CD24A, FLJ22950, FLJ43543, MGC75043,
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Human CD24 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 24, also known as signal transducer CD24 or heat stable antigen CD24 (HSA), is a mucin-type glycosylphosphatidylinositol-linked glycoprotein expressed on the surface of B-cells, differentiating neuroblasts and many tumors. It is involved in molecular adhesion and metastatic tumor spread and serve as a normal receptor for P-selectin. The CD24 / P-selectin pathway could be important in dissimenating of tumor cells by facilitating the interaction with platelet and endothelial cells. It has also been considered as a tumor marker. High rate of CD24 expressions have been found in epithelial ovarian cancer, breast cancer, non-small cell lung cancer, prostate cancer and pancreatic cancer.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Kristiansen G, et al. (2003) Tumour biological aspects of CD24, a mucin-like adhesion molecule. Journal of molecular histology. 35 (3): 255-62.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human CD24 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items