Quick Order

Human TBK1 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human TBK1 cDNA Clone Product Information
NCBI RefSeq:NM_013254.2
RefSeq ORF Size:2190bp
cDNA Description:Full length Clone DNA of Homo sapiens TANK-binding kinase 1.
Gene Synonym:NAK, T2K, FLJ11330
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-TBK1
Restriction Site:KpnI + XbaI (6.1kb + 2.19kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human TBK1 Gene Plasmid Map
Human TBK1 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: HG11023-UT
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"