Quick Order

Text Size:AAA

Human HK3 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HK3 cDNA Clone Product Information
Gene_bank_ref_id:NM_002115.2
RefSeq ORF Size:2772bp
cDNA Description:Full length Clone DNA of Homo sapiens hexokinase 3 (white cell).
Gene Synonym:HXK3, HKIII
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-HK3
Restriction Site:KpnI + XbaI (6.1kb + 2.77kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human HK3 Gene Plasmid Map
Human HK3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

Hexokinase-3, also known as Hexokinase type III, HKIII and HK3, is a protein which belongs to the hexokinase family. Hexokinase-3 / HK3 is an enzyme which in humans is encoded by the HK2 gene. Hexokinases phosphorylate glucose to produce glucose 6-phosphate, committing glucose to the glycolytic pathway. In mammalian tissues hexokinase exists as four isoenzymes encoded by distinct genes. These proteins are homologous and are organized in two homologous domains, with the exception of hexokinase type IV which has only one. This organization is believed to be the result of a duplication and tandem fusion event involving the gene encoding for the ancestral hexokinase. The gene encodes hexokinase-3. Similar to hexokinases-1 and hexokinases-2, this allosteric enzyme is inhibited by its product glucose 6-phosphate.

References
  • Palma F. et al., 1996, Mol Cell Biochem. 155: 23-9.
  • Furuta H. et al.,1996, Genomics. 36 (1): 206-9.
  • Colosimo A. et al.,1996, Cytogenet Cell Genet. 74 (3): 187-8.
  • Size / Price
    Catalog: HG11016-UT
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"