After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human TNNC1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TNNC1 cDNA Clone Product Information
Gene_bank_ref_id:NM_003280.2
RefSeq ORF Size:486bp
cDNA Description:Full length Clone DNA of Homo sapiens troponin C type 1 (slow).
Gene Synonym:TNC, TNNC, CMD1Z
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Troponin I, also known as TNNC1, is part of the troponin complex. This complex contains 3 subunits: troponin I (TnI), troponin T (TnT) and troponin C (TnC). Troponin I is the inhibitory subunit, blocking actin-myosin interactions and thereby mediating striated muscle relaxation. It binds to actin in thin myofilaments to hold the actin-tropomyosin complex in place. Because of it myosin cannot bind actin in relaxed muscle. When calcium binds to the Troponin C it causes conformational changes which lead to dislocation of troponin I and finally tropomyosin leaves the binding site for myosin on actin leading to contraction of muscle.

References
  • Kalaji FR. et al., 2012, Saudi J Kidney Dis Transpl. 23 (5): 939-45.
  • Wijnker PJ. et al., 2013, Am J Physiol Heart Circ Physiol. 304 (2): H260-8.
  • Solaro RJ. et al., 2013, Circ Res. 112 (2): 355-66.
  • Size / Price
    Catalog: HG11011-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"