Quick Order

Text Size:AAA

Human CD1D natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD1D cDNA Clone Product Information
Gene_bank_ref_id:NM_001766.3
RefSeq ORF Size:1008bp
cDNA Description:Full length Clone DNA of Homo sapiens CD1d molecule.
Gene Synonym:R3, CD1A, MGC34622,
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 1 (CD1) is a member of CD system. It's a family of glycoproteins expressed on the surface of various human antigen- presenting cells which are implicated in the presentation of lipid antigens to T-cells. Due to the different lipid anchoring, the CD1 family is classified into two groups: group1 (CD1a-c) and group2 (CD1d). CD1d with lipid antigens activate NK T-cells which rapidly produce Th1 and Th2 cytokines after been activated.

References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Joyce S. (2001) CD1d and natural T cells: how their properties jump-start the immune system. Cell Mol Life Sci. 58 (3): 442-69.
  • Size / Price
    Catalog: HG11009-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"