After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SERPINI2 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human SERPINI2 cDNA Clone Product Information
NCBI RefSeq:NM_006217.3
RefSeq ORF Size:1218bp
cDNA Description:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade I (pancpin), member 2.
Gene Synonym:MEPI, PI14PANCPIN, TSA2004
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease inhibitors). Over 1000 serpins have been identified.
Serpin-I2, also known as myoepithelium-derived serine protease inhibitor, Pancreas-specific protein TSA2004, Peptidase inhibitor 14, PI14, SERPINI2 and MEPI, is a secreted protein which belongs to the serpin family. It is expressed in pancreas and adipose tissues. SERPINI2 deficiency directly results in the acinar cell apoptosis and malabsorption.

References
  • Riewald M. et al., 1995, J. Biol. Chem. 270: 26754-7.
  • Forsyth, S. et al., 2003, Genomics 81: 336-45. 
  • Horvath, AJ. et al., 2004, J. Mol. Evol. 59: 488-97.
  • Loftus,S.K. et al., 2005, PLoS Genet. 1 (3):e38.
  • Steenbakkers PJ. et al., 2008, Mycol. Res. 112 (Pt 8): 999-1006.
  • Przygodzka, P. et al., 2010, BMC Cell Biol. 11: 30. 
  • Size / Price
    Catalog: HG11008-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"